Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone YTC453
Clone ID YTC453
Vector pGT0Lxf
Project baygenomics

Sequence tag YTC453
Sequence
GTGCAGGGCGGTCGCTGAGCCGGAGCTGCTGCTGCTAAGCTCTTGGGCTCGGTTGAGACCGCCGTGCTTGCTCCTTGCTC
CAGCCGTCACCGCCGCCGCCGAGGGAGCGGCCGCCTATTGTCCT
Sequence Type mRNA
Unitrap ID UNI5022

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 82600447..82600570 122
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078669 (AC113019.13) Putative uncharacterized protein Fragment [Source:UniProtKB/TrEMBL;Acc:Q3TA34]

 
Come back to gene ENSMUSG00000078669


For any suggestions or comments, please send an email to unitrap@crg.es