Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST278117
Clone ID OST278117
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST278117
Sequence
CCCACTTCTCAATGGACAACCCCAGCTCANACCCGTTGCCTTCAACTTTGTCTGGGGAGGAAGAAAAACCTCTGGCCTTA
CTGCCTCCTGTTCCCCGGGGGCGCCGAGGCCGACCTCCAGGGGGAGCCACCACCTCCAATCGGACTCTCAAGTCCTCCCT
CCCTCGAAAGAGGGGCCGTCCCCCCAGATCAGAGCAGGAAACCCCGTTGACAGCACCAGTGGACAGCGGNGGCAGCAGCG
ATCTTCTGTTGATCGATGATCAGGGTGTTCCTTATACAGTTCCTGAAGGGTCAGCAGCAGATGGGCCCCAGGGCTCTGGT
TCCAAGAGGGCTCCGCACTTCTGTCCCGTGTGCCTGANAGCCTTCCCCTACCTCTCTGACCTGGAGCGCCACAGCATCTC
ACACTCAGAATTGAAGCCACACGTGTGCAAAGATTGCGGCAAGACCTTCAAACGGTCCAGCCACTTGCGGCG
Sequence Type mRNA
Unitrap ID UNI23051

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 4969066..4969537 466
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000051184 (Zfp524) NM_025324 zinc finger protein 524 Gene [Source:MGI Symbol;Acc:MGI:1916740]

 
Come back to gene ENSMUSG00000051184


For any suggestions or comments, please send an email to unitrap@crg.es