Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST278014
Clone ID OST278014
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST278014
Sequence
TTCTTCTTTCTCCTTTGCCTGGCCGGGAGGGCCCTGGCAGCCCCTCAGCANACTGANGTTGCTGAGGAGATAGTGGAGGA
GGAAACCGTGGTGGAGGAGACAGGGGTACCTGTGGGTGCCAACCCAGTCCAGGTGGAAATGGGAGAATTTGAGGACGGTG
CAGAGGAAACGGTCGAGGAGGTGGTGGCTGACAACCCCTGCCAGAACCATNATTGCAAACATGGCAAGGTGTGTGAGCTG
GACNAGAGCAACACCCCCATGTGTGTGTGCCAGGACCCCACCAGCTGCCCTGCTCCCATTGGCGAGTTTGAGAAGGTATG
CANCAATGACAACAAGACCTTCGACTCTTCCTGCCACTTTTTTGCCACCAAGTGCACCCTGGAGGGCACCAAGAAGGGCC
ACAAGCTCCACCTGGACTACATNGGACCATGCAAATACATCNCCCCCTGCCTGNATTCCNAGCTGACCGAATTCCCT
Sequence Type mRNA
Unitrap ID UNI12984

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 55212787..55223473 121
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018593 (Sparc) NM_009242 secreted acidic cysteine rich glycoprotein Gene [Source:MGI (curated);Acc:Sparc-002]

 
Come back to gene ENSMUSG00000018593


For any suggestions or comments, please send an email to unitrap@crg.es