Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST277645
Clone ID OST277645
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST277645
Sequence
CTAGGCCAACAGTGAGCGCACCTTCATTGCCATCAAGCCTGATGGGGTCCAGCGGTTGGCTGGTGGGCGAGATCATCAAG
CGGTTCGAGCAGAAGGGGTTCCGGGCTTGTTGGTCTGAAGTTTCTGCAGGCTTNAAAGGACCTTCTCAAGGAGCACTACA
CTGACCTGAAGGACCNGCCCCTTCTTTACTGGCCTGG
Sequence Type mRNA
Unitrap ID UNI17175

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 93824576..93827245 115
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037601 (Nme1) NM_008704 non-metastatic cells 1, protein (NM23A) expressed in Gene [Source:MGI (curated);Acc:Nme1-001]

 
Come back to gene ENSMUSG00000037601


For any suggestions or comments, please send an email to unitrap@crg.es