Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST277609
Clone ID OST277609
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST277609
Sequence
AAATTCTCTGACTACAACAATATCAACACCAACATGATTGCTACCCTGTTCAGTAGCCTTCTCCTAAGACCTCCACCAAA
CCTCATGACAAGACGT
Sequence Type mRNA
Unitrap ID UNI18599

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 45316390..45316690 55
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001173 (Ocrl) NM_177215 oculocerebrorenal syndrome of Lowe Gene [Source:MGI (curated);Acc:Ocrl-001]

 
Come back to gene ENSMUSG00000001173


For any suggestions or comments, please send an email to unitrap@crg.es