Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST277561
Clone ID OST277561
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST277561
Sequence
GACTGAGGTCCTCAGTATGGCAGCCTGGAGCGGGCGTGGGGCGCCATGATGACAGAAGCAGATAAGGTCAGCGAGCTGCA
CCAGGAGGTGAAGAACAGCCTGCTGAATGAGGACCTGGAGAAAGTCAAGAACTGGCAGAAGGATGCCTATCACAAGCAGA
TCATGGGTGGCTTCAAGGAGACGAAAGAGGCCGAGGATGGCTTCCGAAAGGCCCAGAAGCCCTGGGCTAAAAAGATGAAG
GAGCTAGAGGCGGCCAAGAAGGCCTATCACTTGGCTTGTAAGGAGGAAAGGCTGGCCATGACCCGGGAGATGAACAGTAA
GACAGAGCAGTCGGTCACCCCTGAACAGCAGAAGAAACTTGTGGACAAAGTGGACAAATGCAGACAGGATGTGCAAAAGA
CTCAGGAGAAGTATGAGAAGGTGCTGGAAGATGTGGGCAAGACCACACCACAGTACATGGAGGGCATGGAGCAGGTGTTT
GAGCAGTGCCAGCAGTTTGAGGAGAAGCGGCT
Sequence Type mRNA
Unitrap ID UNI13070

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 27841788..27842974 239
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040276 (Pacsin1) NM_011861 protein kinase C and casein kinase substrate in neurons 1 Gene [Source:MGI (curated);Acc:Pacsin1-001]

 
Come back to gene ENSMUSG00000040276


For any suggestions or comments, please send an email to unitrap@crg.es