Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone YTC491
Clone ID YTC491
Vector pGT0Lxf
Project baygenomics

Sequence tag YTC491
Sequence
CTCTCGGTCCCATATTGAACTCGAGTTGGAAGAGGCGAGTCCGGTCTCAAAATGG
Sequence Type mRNA
Unitrap ID UNI5036 UNI5037 UNI5038 UNI5039

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 145530309..145530363 55
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 8784175..8784229 55
 
EST/CDNA Est Name
  BC057655.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 75497324..75497378 55
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000059005 (Hnrpa3) NM_146130 heterogeneous nuclear ribonucleoprotein A3 Gene [Source:MGI (curated);Acc:Hnrpa3-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 54285337..54285391 55
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069014 (AC121785.3)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 12159929..12159983 55
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060989 (AL805912.5)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 66639847..66639901 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114538905..114538959 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 77702027..77702081 55
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000067669 (AL844863.7)  

 
Come back to gene ENSMUSG00000067669


For any suggestions or comments, please send an email to unitrap@crg.es