Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST277435
Clone ID OST277435
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST277435
Sequence
GACTGAGGACCAGGAGNAAAATGGCATCCCAGATGCACACATCAATAAGTTCTGGAGATGAAGGAAAAGATGCTGTACTC
AAAAAGGAAAGACCCTACAAGATCTTTTTCAAAGATCTCTTCGTTTTCAAAGAAAATGAAATTGCTGCCAGGAAAAAGGA
GAGAATGAAGAACCACAGCATGAAAATCTACCAGAAGACAACATTTTCGTCCCGAATGAAGAGTCGCTCACACCTTGGCC
AGCTAGCTTTTTTCGCTGACGCAGGCAGCTCCTCCTATGAACGTCTGGGGCTAGATCCCACTCTTATTCTCAGGCTGACA
GAAGGTGCAGACNCACCNACGCCTGGNCNCCCTTTNNNNNTCNACCAGGNCNNNANGGCTCNNCTNAANGGGNACTTTGC
GGTCANNNNCTCCCGTNGAGAAAGCAAGCCATGAGGCTGGAGAGACGGCTTANTCAAGAGCCCTTTGCGACTCTTGCAGA
AGACCAGGGGTTGGGTCCCAGCATCCTGG
Sequence Type mRNA
Unitrap ID UNI23070

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 93008198..93014960 168
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036168 (Ccdc38) NM_175488 coiled-coil domain containing 38 Gene [Source:MGI (curated);Acc:Ccdc38-001]

 
Come back to gene ENSMUSG00000036168


For any suggestions or comments, please send an email to unitrap@crg.es