Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone YTC518
Clone ID YTC518
Vector pGT0Lxf
Project baygenomics

Sequence tag YTC518
Sequence
CTTCAAGATGCACTGGGTGTGACAGACAAGAGTCTTCCCCCTTTCATCTACCGGATGCGCCAGCTGGGCTACCCACCGGG
CTGGCTCAAGGAGGCTGAACTGGAGAATTCTGGACTTGCACTCTATGATGGAAACGATGACGCTGATGGGGAAACAGAAA
CTGGAGAAATACAGAATAAAAATGTCACCTACGATCTCTCAAAATTGGTAAACTATCCAGGTTTTAATATATCTACTCCC
AGAGGTATTCCAGATGAATGGAGAATGTTCGGTTCCATACCAATGCAGGCGTGTCAACAGAAGGATGTGTTTGCCAGTTA
CCTTAATTCTAACATCCAGTCGCCGAGTATGAGATCTAGCGGCAAGCGGTCTTCCTCGCAGTCCAGCCCTAACAGTCCAA
AGAAGCAGCGAAAGGAGGGCAGTGCGGCGGCCTCCCCTGCCGACACGGAGCGAGACT
Sequence Type mRNA
Unitrap ID UNI5053

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 124152575..124157413 136
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029427 (Zcchc8) NP_081770 zinc finger, CCHC domain containing 8 Gene [Source:MGI Symbol;Acc:MGI:1917900]

 
Come back to gene ENSMUSG00000029427


For any suggestions or comments, please send an email to unitrap@crg.es