Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST277104
Clone ID OST277104
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST277104
Sequence
GGTCTTCTTGTGGGCACCCTGGCNGTGGNGCTGGCACTCCAGCGCCCGTGTGGCCCCTTACCGCATNCTGCACCAGACCC
AGGACTCGCAGGTCTACTGGATAGTGGCATGTGGTTCTTCCCGAAAAGAGATCACCAAACACTGGGAATGGCTGGAAAAC
AACTTGCTTCAGACACTGTCCATCTTCGACAACGAGGAGGACATCACTACCTTCGTCAAGGGCAAGATACACGTANGGCC
CATGTCCCACCGACAACCAACCCAGCTCCCTTTGTGAAGNGCTAGCGGCCACACACAGTTGTTGNTCCATATCTGCGGGA
TACAANGAATTCCATGGATTCAAA
Sequence Type mRNA
Unitrap ID UNI23081

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 49953884..49954114 221
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036644 (Tbc1d9b) NM_029745 TBC1 domain family, member 9B Gene [Source:MGI (curated);Acc:Tbc1d9b-002]

 
Come back to gene ENSMUSG00000036644


For any suggestions or comments, please send an email to unitrap@crg.es