Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST276817
Clone ID OST276817
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST276817
Sequence
GACTGAGATTTCTCAGCCCCAATGTTTAGACAAACCTCAATAAAATGACTCTTCAGGAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI23090

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 77331159..77331212 50
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000055923 (Aasdh) NM_173765 aminoadipate-semialdehyde dehydrogenase Gene [Source:MGI Symbol;Acc:MGI:2442517]

 
Come back to gene ENSMUSG00000055923


For any suggestions or comments, please send an email to unitrap@crg.es