Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone YTC747
Clone ID YTC747
Vector pGT0Lxf
Project baygenomics

Sequence tag YTC747
Sequence
ACGAAAAGTAGCCGCCATATCAGTTGCTCAGAGGGTTGCTGAGGAAATGAAATGCACTTTGGGATCTAAAGTAGGATACC
AAGTTCGTTTTGATGATTGCAGCTCCAAGGAAACAGCAATCAAATACATGACTGATGGATGTTTACTCAAACATATTTTG
GGAGATCCAAATCTTAGCAAATTCAGTGTCATTATTTTGGATGAAGCCCATGAAAGAACTTTAACTACAGATATCTTATT
TGGTTTACTGAAGAAGCTGTTTCAGGATAAGTCTCCTAACAGGAAAGAGCATTTAAAGGTGGTAGTGATGTCAGCAACTA
TGGAACTAGCCAAGCTCTCTGCATTCTTTGGAAATTGCCCCATATTTGATATACCTGGAAGACTCTATCCAGTCAGAGAG
AAATTCTGCAATTTGATCGGACCACGAGACAGAGAAAATACTGCATATATTCAAGCGATTGTGAAAGTGACCATGGATAT
TCATTTGAATGAAATGGCTGGAGACATCTTAGTTTTTCTGACTGGCCAGTTTGAGATAGAGAAGAGTTGCGAGCTGCTCT
TTCAGATGGCGGAGTCTGTTGACTATGATTATGATGTACAAGATACCACGCTAGATGGCTTGTTGATTCTGCCATGTTAC
GGCTTT
Sequence Type mRNA
Unitrap ID UNI5060

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 86611137..86617867 228
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018425 (Dhx40) NM_026191 DEAH (Asp-Glu-Ala-His) box polypeptide 40 Gene [Source:MGI (curated);Acc:Dhx40-001]

 
Come back to gene ENSMUSG00000018425


For any suggestions or comments, please send an email to unitrap@crg.es