Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST276425
Clone ID OST276425
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST276425
Sequence
TAGATGCCTCCTTGAGACCCCTTCGAGCGCACCTGGCCCCAGCCCCCAGAACTGCCCGGGATCGACTACTCCATGGATGA
GCAATGCCGGTTCGACTTTGGCACTGGGTACCACACCTGCTTAGCTTTCAGGACCTTTGAGCCCTGCAAGCAGCTATGGT
GCAGCCACCCTGACAACCCATACTTCTGCAAGACCAAGAAGGGGCCTGCCGCTGGATGGGACAGAGTGTGCACCAGGCAA
GTGGNGCTTCAAAGGCCATTGTATCTGGAAGTCACCAGAGCAAACTTATGGCCAGGATGGAGGCTGGAGTTCCTGGACCA
AATTTTGGCTNATGTTTCTNGGTCAGTGTTGGAGGAGGGGTGC
Sequence Type mRNA
Unitrap ID UNI23098

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 60684637..60687143 120
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000059901 (Adamts14) NM_001081127 a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 14 Gene [Source:MGI (curated);Acc:Adamts14-001]

 
Come back to gene ENSMUSG00000059901


For any suggestions or comments, please send an email to unitrap@crg.es