Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST276317
Clone ID OST276317
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST276317
Sequence
TAATTGCTACCTCATGTCTAAAGAAATCCCCTTTTNTGNGAAAAAGACTAAAAGTATCTTCAACAGCTGCCATGCATAGA
GATGGAAGTTTACGGTGGAGAACATACGGAGGAAGTTTGGGGTTTTTAATTACTCCCCGTTCAGGACGCCCTACACGCCC
AACAACCAGTACCAAATGCTGCTGGATCCCAGCAACCCCAGCGCGGGCNCAGCCAAGACAGACAAACAGGAGAAGGNGAA
GCTTANTTTTGACATGACAGCGTCCCCCAAGATCCTTCTGAGCAAGCCCCTTCTGAGCGGGGGTGCCGGCCGCAGGATCT
CCCTGTCCGACATGCCTCGCTCCCCCACCAGTACGAACTNTTNCGTGCACACGGGCTCCGATGTGGAGCAGGACCCCGAG
AAGAAGGCCCCGTCCAGCCACTTCAGCGCAAGCGAGGAGTCCATGGACTTCCTTGATAAGAGCACAGG
Sequence Type mRNA
Unitrap ID UNI5045

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 165653707..165654171 442
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039671 (Prkcbp1) NP_081506 protein kinase C binding protein 1 Gene [Source:MGI (curated);Acc:Prkcbp1-010]

 
Come back to gene ENSMUSG00000039671


For any suggestions or comments, please send an email to unitrap@crg.es