Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone YTC563
Clone ID YTC563
Vector pGT0Lxf
Project baygenomics

Sequence tag YTC563
Sequence
GGTGCAGAGTGAGCTCATGCACCTGCCCAGCGGCAAGGTGGGCTTCAGCAAGGCCATGTCCAACAAGTGGATCCGAGTGG
ACAAGAGTGCCGCCGACGGGCCCCGGGTGTTCCGAGTGGTGGACAGTATAGAGGATGAAGTGCAGAAGCGGTTGCAGCTG
GTCCAGGCAGGCCAGGCTGAGAAGCTGGCTGAAAAGGAACGGAATGAGCTCCGGAAGAGGAAGCTGCTGACGGAAGTGAT
CCTGAAAACCTACTGGGTGAGCAAGGGCAAGGCCTTCAGCACAAGCGTGTCTAAGCAGGAGGCAGAGCTGAGCCCAGAGA
TGATCTCCAGTGGCTCTTGGAGGGACCGACCTTTCAAACCCTACAACTTCTCTGCCCGTGGTGTGCTCCCAGATAGTGGC
CACCTGCACCCCTTGCTCAAGGTCCGCTCTCAGTTCCGACAAATCTTCTTGGAGATGGGGTTCACTGCAGATGCCTACGT
ACAATTTCACTGAGAGCTCCTTCTGGAACTTTGATGCACTCTTTCAGCCTCAGCAGCACCCAGCAACCTATCAACATGAC
ACTTTCTTCCTG
Sequence Type mRNA
Unitrap ID UNI5073

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 87384924..87388447 133
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000003808 (Farsa) NM_025648 phenylalanyl-tRNA synthetase, alpha subunit Gene [Source:MGI (curated);Acc:Farsa-001]

 
Come back to gene ENSMUSG00000003808


For any suggestions or comments, please send an email to unitrap@crg.es