Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST276149
Clone ID OST276149
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST276149
Sequence
CTGAGGGATGATCTCTTCATTTTTACTAGTATACCTGTCAACCTTGTTCATCTCTTTTGTATTTGGAGAAGCGGAAATAA
GATTCACTGGACAGACAGAGTTCTTCGTTAATGAGACAAGTACCACAGTTATTCGTCTTGTCATTGAGAGGATAGGCGAG
CCCGCAAATGTTACTGCCATTGTGTCGGTGAGCGGAGAACACACCTGGTGACTTTTTTGATACNTACGCCGCNCTGTTTA
TCCCTGCCAGAGGAACNANCANGANAGTGNNCATAGNAGTATGNGACNACTNNNTNNCGGAGNCTGNNGAAACNTTCNCA
TTTCACTNGACATTACAGAAACCCTCAGCATNTGTNAAACTNGNATNGNCAAGGGCTGCTTNTGTNACNATCCNATCAAN
NGACAANGCATTTGGAATNATTTTCCTTTAGTNCGCCCTCATACATCTCGGTGATACGAGCCAAGGAGCAGNAAANGCAT
NTGCACCTNTTACTCTCATCAGAGAAAGAGGGTCCT
Sequence Type mRNA
Unitrap ID UNI23109

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 81723066..81734359 190
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069170 (Gpr98) NM_054053 G protein-coupled receptor 98 Gene [Source:MGI Symbol;Acc:MGI:1274784]

 
Come back to gene ENSMUSG00000069170


For any suggestions or comments, please send an email to unitrap@crg.es