Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST276026
Clone ID OST276026
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST276026
Sequence
GAACTGAGGGGCCCCAGCAGTATAGTGGGTGTGGCCATGGGGAAGCGGTACTTCTGTGACTACTGNGACCGCTCCTTCCA
GGACAACCTCCACAACCGAAAGAAGCACCTGAATGGACTGCAGCACCTNAAGGCCAAGAAGGTGTGGTACGACATGTTCC
AGAGATGCAGCCTGCCATCTTGCTGGATGAACAGAACAAGCTGGCCCTGCAGGAAATTCCTGCTGACAGGCCAGTGCGAC
TTTGGCTCCAACTGCAGGTTTTCCCACATGTCAGAACAAGATCTGCAGGAGCCTGAGCGTCCAGGTGGAAGAGGAGAGGC
GGGCCAGAGAATGGCCCCTAGAGACCGCCGAGCTTCCTGAGGGCCACCTGGAGGACTGGCTGGAGAAGAGAGCTAAGAGG
CTAAGCTCAGCCCCAAGTAGCAGGGCTGAACCCATCAGAACCACTGTCTTCCAGTATCCAGTGGGCTGGCCGCCAATGCA
GGAGCTGCCCCCCTCCCTGCGGGCACCCCCACCTGGAGGA
Sequence Type mRNA
Unitrap ID UNI14590

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4622359..4637430 145
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000009076 (Zmat5) NM_026015 zinc finger, matrin type 5 Gene [Source:MGI (curated);Acc:Zmat5-001]

 
Come back to gene ENSMUSG00000009076


For any suggestions or comments, please send an email to unitrap@crg.es