Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST275996
Clone ID OST275996
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST275996
Sequence
CCACTATTAAAGAGCTGAAAGAAAACATCATGAGTATTTCTTCCTTAGGAAGTATTGGGAAAGGGAGAACTGTACCATCT
GGTGAAGAGGAGCGCAATAATATCCTAAGACAGATGAAAGTACCGGACTACACTAAAGGGTGACCAGAGCTGGATCACCA
AGCATGATGACTCTGAGGATCATACCATAGAGCCACTCTCACGTCACAACCGAGCCACATCCTTCTCATCAGTCAGAGAC
GAATCAAATGCCAGGTCTCCAAACGCAAGGGCTCCAGCTGGTTACATAATCCGGGGAGTGTTCACCCGAACAATAGATAG
CTCTTCTCACTCCCAGCATCGCCCCTCTAAGACCAACGGAGCTCCAAGAAGTGCTTCTGGGCAGCTGGGANCAGCTAATT
TTGGTCATCCTCTTCAGTCGTCTGGCTATAAGATGACNACGGNAGATTATNAGAAACTAGCACCGCACAACATAAGGCGC
AG
Sequence Type mRNA
Unitrap ID UNI23113

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 70242387..70244676 123
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031351 (Zfp185) NP_001102513 zinc finger protein 185 Gene [Source:MGI (curated);Acc:Zfp185-001]

 
Come back to gene ENSMUSG00000031351


For any suggestions or comments, please send an email to unitrap@crg.es