Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST275976
Clone ID OST275976
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST275976
Sequence
ATGCAGTACCAAATGCAATACCTGGGAGAACAGACATAGAGTTGGAAATATATGGCATGGAAGGTATTCCAGAGAAAGAT
ATGGATGAAAGACGGCGACCTTCTTGAACAGAAAACACAAGAGAGTCAGAAAAAGAAACAACAAGATGATTCTGATGAAT
ATGATGATGATGAATCTGCAGCCTCAACTTCCTTTCAGCCACAGCCTGTTCAACCTCAGCAAGGTTATATCCCACCAATG
GCTCAGCCAGGACTGCCTCCAGTTCCAGGGGCACCAGGAATGCCTCCAGGCATACCTCCATTGATGCCAGGNGTTCCTCC
CCTGATGCCANGCATGCCTCCANTGATGCCAGGAATGCCGCCTGGATTGCATCATCAGAGAAAATACACCCAGTCATTTT
GCGGNGAAAACATAANGATGCCAATGGGCGGAATGATGCCACCTGGACCTGGAATACCACCTCTGATGCCAGGTATGCCA
CCAGGTATGCCC
Sequence Type mRNA
Unitrap ID UNI18900

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 80201323..80204908 171
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017421 (Zfp207) NP_035881 zinc finger protein 207 Gene [Source:MGI (curated);Acc:Zfp207-002]

 
Come back to gene ENSMUSG00000017421


For any suggestions or comments, please send an email to unitrap@crg.es