Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST275908
Clone ID OST275908
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST275908
Sequence
GACTGAGGTAACCAGGCTTTGATGCACCCTCAGGAAGTCTGTGCACTCGAGGAGGCCACCCCCCGCCGGCTGCTGCTCAC
ATGGTTTCTGGGCCCCTGGCACTCCGGTGGTGCCCGTGGGCAGGGCACAGGGACATGGGGCCAGACATGGAGCTTCCCAG
CCATTCAAAACAGCTCCTGCTACAGCTGAACCAGCAGAGGGCCAAGGGCTTCCTGTGTGACGTCATCATCATGGTGGAGA
ACTCTATCTTCCGGGCCCACAAGAATGTCCTGGCTGCTAGCAGCATCTACTTCAAGTCCCTGGTCCTGCATGATAACCTC
ATCAACTTAGACACAGACATGGTCAGCTCCACTGTGTTCCAGCAGATCCTGGACTTCATCTACACAGGCAAGCTCCTGCC
CAGTGACCAGCCATCTGAGCCAAACTTCAGCACTCTACTCACTGCTGCCAGCTACCTCCAGCTGCCTGAGTTGGCAGCCC
TCTGTCGCCGCAAACTGAAGCGAGCTGGCAA
Sequence Type mRNA
Unitrap ID UNI6723

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 17255059..17257832 408
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000050240 (Hic2) NM_178922 hypermethylated in cancer 2 Gene [Source:MGI Symbol;Acc:MGI:1929869]

 
Come back to gene ENSMUSG00000050240


For any suggestions or comments, please send an email to unitrap@crg.es