Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST275856
Clone ID OST275856
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST275856
Sequence
GCCGGAGCGATCGGACAAGTTCCAGGAGACGTCGGTCTTCAATGAGACTCTGCGGATCGAGCGCATCGCACGCACGCAGG
GAGGTCGCTACTACTGCAAGGCGGAGAACGGAGTGGGCGTGCCGGCCATCAAGTCTATCCGCGTGGACGTGCAGTACTTG
GATGAGCCTGTGCTAACCGGTGCATCAGACAGTGAGCCGATGTCCGAGGCAACTTCTACCAGGAGAAGACCGTGTTTCTA
CGCTGTACCGTCAGCTCCAACCCGCCCGCCCGCTTTATCTGGAAGCGGGGCTCCGACACCCTGTCCCACAGCCAGGATAA
TGGGGTTGACATCTACGAGCCTCTCTATACTCAGGGGGAGACGAANGTCCTGAAGCTGAAGAACCTGCGGCCCCAAGACT
ATGCCAGCTACACCTNCCAGGTGNCCGTGCGCAATGTGTGCGGCATCCCAGACAAGGNTATCACCTTCCAGCTCACCAAC
ACCACGGCACCTG
Sequence Type mRNA
Unitrap ID UNI23116

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 29986585..29989543 195
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000043557 (Mdga1) NM_001081160 MAM domain containing glycosylphosphatidylinositol anchor 1 Gene [Source:MGI Symbol;Acc:MGI:1922012]

 
Come back to gene ENSMUSG00000043557


For any suggestions or comments, please send an email to unitrap@crg.es