Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST275800
Clone ID OST275800
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST275800
Sequence
GACTGAGGAATTGGGAAGAACGTGGNGTGTGANAAGGCAGNGACATCCATGGACGCCTTCCGGATGGTGACCGCATCTCG
CTACTACCCACAGCTGATGAGCTTGGTGGGGAACGTTCTGCGCTTCCTGCCTGCCTTCGTGCGCATGAAACAGCGTCATT
GCAGAGCACCTACGTGGGTGCCCGTGATGATCTGCGACGCTCGCATCTACTCCGGGAGCCTGCTCAGCCCCAGCTACGGC
TGGATCTGTGACGAGCTTATGGGGGGCGGGGGCCTGCACACCATGGGTACCTATATCGTGGACCTGTTGACCCACTTGAC
TGGCCAGAAAGCCGAGAAGGTGCACGGGCTCCTCAAGACCTTTGTGAGGCAGAATGCCACCATCCGTGGCATCCGCCATG
TCACCAGTGATGACTTNTGTTTTTTCCANATGCTCATGGGTGGGGGGG
Sequence Type mRNA
Unitrap ID UNI23119

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 108241113..108241552 421
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000013150 (Gfod2) NM_027469 glucose-fructose oxidoreductase domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1917825]

 
Come back to gene ENSMUSG00000013150


For any suggestions or comments, please send an email to unitrap@crg.es