Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST275725
Clone ID OST275725
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST275725
Sequence
GACTGAGGTGGGGCCCAGGCCTGGGTTGCCATGGATACCGTGTCCCTGGAGCATCAGATCCAGAGCGTGCAACGCCACAT
CAGCTTCCTGAAAAAGGAGCAGGTGGCCCTGCTTCGAGACCTGCACCTGGAGATCCTGAGGCTGCAGAAACGCTGCTCAG
GTGAGGCNGAATACCTGGCCGCTGGGTGACTGGAGTAAGGAGAGGGTCACCATCACCAGTTTTGCTAGTGGGATGCTCTC
CTTAAGTCCCTGTGAGCCTAACACCAGTTCTGTCTTGTCTCTTTCTGGATGAGAATTAAGACTTGGGGTAGA
Sequence Type mRNA
Unitrap ID UNI20164

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 74443459..74443762 293
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069814 (E130309D14Rik) NM_001013784 RIKEN cDNA E130309D14 gene Gene [Source:MGI Symbol;Acc:MGI:3588240]

 
Come back to gene ENSMUSG00000069814


For any suggestions or comments, please send an email to unitrap@crg.es