Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone YTC632
Clone ID YTC632
Vector pGT0Lxf
Project baygenomics

Sequence tag YTC632
Sequence
AGGTCCACTTGTCATCTATTCATTATTCTTCAAAGAGAAATTCAAAGAAGAGAAACAAGAAATGGCTGATTCTTCAGTCA
ACTTGTCCCAGGGTCTGTTGACATTCCGGGATGTGACTGTGGACTTCTCCCAGGAGGAGTGGGAATGCCTGGACTCTGCT
CAGAGGGCTCTGTACATTGAAGTGATGTTGGAGAATTACAGCAACCTGGTATATGTC
Sequence Type mRNA
Unitrap ID UNI5089

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 21564699..21567284 129
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023882 (Zfp54) NM_011760 zinc finger protein 54 Gene [Source:MGI Symbol;Acc:MGI:99201]

 
Come back to gene ENSMUSG00000023882


For any suggestions or comments, please send an email to unitrap@crg.es