Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST275433
Clone ID OST275433
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST275433
Sequence
ACTGAGCCTAGGACCTGCCTTGTGGGCACACTGGGCACCATGGACCCCCCAGGGTACAATTGCTTTGTGGATAAGGACAA
GATGGATGCATNCATCCAGGACCTGGGGCCAAAGGAGCTGAACTGCACGGAGCTACAGGAGCTGAAGCAACTGGCACGGC
AGGGTTACTGGGCATCAGAGCCACACCCTGCGCGGGAAAGTGTACCAGCGCCTGATCCGGGACATCCCCTGCCGCACAGT
CACACCTGATGCCAGCGTGTACAGTGACATTGTGGGGAAGATTGTGGGCAAGCACAGCAGCAGTAGTCTGCCCTTGCCTG
AGTTTGTAGACAACACTCAGGTGCCCACCTACTGCTTGAACACACGGGGTGAAGGGGCTGTGCGCAAGATCCTCCTGTGT
ATTGCCAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI23132

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 24322746..24323148 396
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036473 (Tbc1d24) NM_173186 TBC1 domain family, member 24 Gene [Source:MGI Symbol;Acc:MGI:2443456]

 
Come back to gene ENSMUSG00000036473


For any suggestions or comments, please send an email to unitrap@crg.es