Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST275233
Clone ID OST275233
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST275233
Sequence
GACTGAGACACGAAAATTAACGCAGAAAATAAGGCCAAGGTCAGTATGGCAGGCGCCAAGCGTGTGCCTGTGACAGTTAC
TGCTGCTTCCAAGCCCGGGCTGAGACCGAGAACTGCTCTTGGAGACATTGGTAATAAAGTCAGCGAAGAGCTACAGGCAA
GAGTGCCTCTGAAAAGGGAAGCAAAAACAGCATAGGTACTGGAAAAGGTACTGTTAAAGCCCTACCAAAACCTGTAGAGA
AGGTGCCTGTGTGTGAACCAGAGGTGGAACTTGCTGAGCCTGAGCCTGAACCTGAACTTGAACATGTTAGAGAAGAGAAG
CTTTCTCCTGAACCTATTTTGGTTGATAATCCCTCTCCAAGCCCGATGGAAACATCTGGATGTGCGCCTGCAGAAGAGTA
TCTGTGTCAGGCTTTCTCTGATGTAATCCTTGCAGTGAGTGACGTAGACGCAGATGATGGGGCTGACCCAAACCTCTGTA
GTGAATATGTGAAAGATATCTATGCTT
Sequence Type mRNA
Unitrap ID UNI23140

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 101553437..101555857 171
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041431 (Ccnb1) NM_172301 cyclin B1 Gene [Source:MGI (curated);Acc:Ccnb1-001]

 
Come back to gene ENSMUSG00000041431


For any suggestions or comments, please send an email to unitrap@crg.es