Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST275012
Clone ID OST275012
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST275012
Sequence
ACTGAGGTGAAAAAAGCCCTTTGTGTCCTCATTCACCACAACCTGGTCCTCTATCATGTGCACAAGCGCGGTGTGGTGGA
GTATGAAGCCCAGTGCAGCCGGGTACTGAGGATGCTTAGGTATCCCCGGTACATCTACACCACCAAAACGCTGTACGGTG
ACACCGGAGAGCTGATTGTTGAGGAGCTCCTGCTGAATGGCAAAATGACAATGTCAGCTGTTGTGAAGAAAGTAGCCGAC
CGACTCACAGAGACCATGGAGGATGGCAAGACCATGGACTACGCTGAGGTATCAAATGCATTTGTGCGACTGGCAGATAC
TCACTTTGTACAGCGCTGTCCCCTGGTTCCTGACACTGACAGTTCTGACCCTGGGCCACCGCCACCCGCCCCAACCCTTG
TCATTAATGAAAAGGACATGTACCTAGTTCCCAAACTGAGCTTGATAGGTAAGGACTTTACATCCTAAAGCTGATTTGCC
TTAATTGGGGACTCTTCTTTGCT
Sequence Type mRNA
Unitrap ID UNI23148

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 96527382..96527977 258
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028099 (Polr3c) NP_083201 polymerase (RNA) III (DNA directed) polypeptide C Gene [Source:MGI Symbol;Acc:MGI:1921664]

 
Come back to gene ENSMUSG00000028099


For any suggestions or comments, please send an email to unitrap@crg.es