Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone YTC719
Clone ID YTC719
Vector pGT0Lxf
Project baygenomics

Sequence tag YTC719
Sequence
GTGTGGAGCTTGAAAAACATGCAAAGAAAACAGAGACACTGGGAAAGGATAGTCTCCTCAAAGAAGAGCAAAAGGAAGCA
GGAAAGAGAACGAAGGAAAGCCAAGCGTGCAGAAGACCCCGGTAACGGCACCTGCCCACAGCACAGCAAACGCTTTTTGA
AAGCCTTAACCAAAGAGAAACTTTTGGAAGCCAAACACTCAGGACCAAGACTATGTGTTGACTTGAGCATGACCCAGCAC
ATGTCAAAGAAGGAATTGAGTAGGTTGGCGGGACAGATTCGAAGGTTGTATGGTTCGAACAAAAAAGCCAGCAGGCCCTT
TTGGATCTGCCTTACTGGATTCTCAACTGCCAGCCCCCTCTATGAGGAGTGTCTGAGGATGAACGACGGGTTTTCTGCTT
ACTTGCTGGATGTGACAGAAGAAGACTGCTTTAGCCTTTTTCCTCTGGAAACCCTTGTGTACCTGACTCCTGACTCCGAA
CACT
Sequence Type mRNA
Unitrap ID UNI5100

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 45314107..45320842 155
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035601 (Rg9mtd3) NM_027266 RNA (guanine-9-) methyltransferase domain containing 3 Gene [Source:MGI (curated);Acc:Rg9mtd3-001]

 
Come back to gene ENSMUSG00000035601


For any suggestions or comments, please send an email to unitrap@crg.es