Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone YTC730
Clone ID YTC730
Vector pGT0Lxf
Project baygenomics

Sequence tag YTC730
Sequence
GGCCCTCCCCCTCGCCCGCTCCCCGCTGCCCCAGGACCGCCGGAACCCGCAGCCGGAGCCAGTCAGCCCGGCAGCCGAGG
TTCCTGCCTCAAGACCAGTTGGGTACATCTTTGACACGCCCTCCCACCATGCACTCCTTGGACGAGCCCCTCGACCTAAA
GCTGAGCATCACCAAGCTCCGAGCGGCAAGAGAGAAGAGAGAAAGGACACTGGGTGTGGTCCGGCATCATGCTTTGCATC
GAGAGCTGGGCCTGGTGGACGATAGCCCCGCCCCTGGCTCCCCAGGCTCTCCACC
Sequence Type mRNA
Unitrap ID UNI5102

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 4594857..4608813 218
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000014303 (Glis2) NM_031184 GLIS family zinc finger 2 Gene [Source:MGI (curated);Acc:Glis2-001]

 
Come back to gene ENSMUSG00000014303


For any suggestions or comments, please send an email to unitrap@crg.es