Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST274740
Clone ID OST274740
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST274740
Sequence
GACTGAGGGAGGACAAGCTCTTTGGGGCTACCAGNACAGAAGCAGCAATGCCTGTTGTGTGGCCAACCCTTTTGGATCTC
AGCAGGGATGAATGCAAACGGATTCTTCGAAAATTGGGAGTGGATGACACCNNCTNTTANACCCAGACCCTNAANANGCN
TNNGCAGGGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCAT
CCCTCCACTGTCTTACAGAGACACTTCTTTTCCTGATTAAAGCTCGTTTTTCTAAACCAGAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI23152

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 105798167..105803364 109
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035401 (2210018M11Rik) NM_172280 RIKEN cDNA 2210018M11 gene Gene [Source:MGI Symbol;Acc:MGI:1924203]

 
Come back to gene ENSMUSG00000035401


For any suggestions or comments, please send an email to unitrap@crg.es