Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST274696
Clone ID OST274696
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST274696
Sequence
GACTGAGGCCCACGAACATCCCAGGTCACTGAGTGGAGGGCCCTGGACCCCGGGCGAATGCAGATGCCGCAGGGGAACCC
ACTGCTGCTGTCCTACACCCTGCAGGAGCTGCTGGCCAAGGACACGGTGCAGGTGGAGCTCATCCCTGAGAAGAAGGGCC
TCTTCCTTAAGCATGTGGAGTACGAGGTTTCCAGCCAGCGCTTCAAGTCCTCCGTGTACAGACGCTACAATGACTTCGTG
GTCTTCCATGAAGTGCTGCTTCACAAGTTCCCCGTACCCGCATGGTTCCAGCTCTTCCGCCCAAGAGAGTGCTGGGAGCC
GACAGGGAGTTCATCGAGGGCCGCCGGAGGGCCCTGAAGCGCTTCATCAACCTGGTGGCCCGGCACCCACCCTTCTCTGA
GGGACGTGCTCCTTAAACTCTTTCCTCTTCCTTCAGTGGGCTCGGATGTTCAACACAAGCTCAAGGANGGCGGCCCAAGT
GCGTGGGAGATGAGTTCANTGAACTGTAAGCTGGCCTGCTAAGGGCCCAAGGGACCTTTCTT
Sequence Type mRNA
Unitrap ID UNI9642

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 140829377..140836338 193
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029560 (Snx8) NM_172277 sorting nexin 8 Gene [Source:MGI Symbol;Acc:MGI:2443816]

 
Come back to gene ENSMUSG00000029560


For any suggestions or comments, please send an email to unitrap@crg.es