Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST274691
Clone ID OST274691
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST274691
Sequence
GACTGAGGATCTAGCAGCAGAAAGCAGCTCTNCTTCCCTGCAAAGGAGCTGGGCACCGTCGCCATGAAGTTCATGCTGAA
CCTCTATGTGCTGGGCATCATGTTGACCCTGCTTTCCATCTTTGTTAGAGNGATGGAGTCTCTGGGAGGCTTACTGGAGA
GCCCACTGCCCGGGAGCTTCCTGGATCACGAGGGGTCAGCTAGCCAACACACAGCCTCCTAAGGGCCTGCCAGACCATCC
ATCCCGAGGAGTGCAGTGAACCTCCCTCCCTGCAGGCATCACAGCTTCAGCATGTCCAACCACACGTTCCATTTCTCGGG
AGGCAGCATCAAGTGTCTCCAAAGGACTCTTACTAGGCCTGGAAGGGCTGTTCCCTTACCCTGGAAAAGAGCCTATTTCC
CCCTANAGCTGTGAGTGGGCTGTCTGTGGCTCTGGGATGGAGGTGTACCAGTTCCAGCTGTTGGGAGAATGGATTTTGGT
TTCGTTTGTTTTAAAACCTCTGTCCTAAAGGACTCTTTTGGACCCTAAGTATCT
Sequence Type mRNA
Unitrap ID UNI18286

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 29224648..29225172 503
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000043421 (2310016C08Rik) NM_023516 RIKEN cDNA 2310016C08 gene Gene [Source:MGI Symbol;Acc:MGI:1916823]

 
Come back to gene ENSMUSG00000043421


For any suggestions or comments, please send an email to unitrap@crg.es