Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone BC0610
Clone ID BC0610
Vector pGT2lxr
Project sanger

Sequence tag BC0610
Sequence
TAGTCTTTTTCCTCTCCCCTCCTATTTCTCTCTCCTTTACTCCGCTTGCCCTACCGCTCTCCCCGCTCGCTCGGTTTTTT
CTCTCCCTCCTTATATTTCGTTCCACCCTGGCCTTGGCCTATCATTGAAGGCGTCATGAGAGTCATCGGGGGTTCTAAAC
ATTTAGCTGTTGTTTTGACTGACATTGTTTTAGCAGTTATTGACTCCATTTTTGTGTGGTTCATTTTTATAAGTTTGGCA
CAGACTATGAAGACTCTAAGGCTAAGAAAGAACACAGTGAAATTTTCATTGTATAGGCATTTTACAAATACACTCATCTT
TGCAGTGCTGGCTTCTATAGTGTTTATGGTGTGGACAACAAAGACCTTCAGGATCGCAAAATGCCAATCAGATCGGATAG
ACATGTGGGGCCCTGGAGTGGTGAGACGTTTTCTTCTCTCACACAGCATCCCTGGAACAAAGTACTCATCCAAGTCGTAA
TCAAAGGTCCCCCCGTACATAGTCCGACAC
Sequence Type mRNA
Unitrap ID UNI419

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 128663104..128667220 110
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000014353 (Tmem87b) NM_028248 transmembrane protein 87B Gene [Source:MGI (curated);Acc:Tmem87b-001]

 
Come back to gene ENSMUSG00000014353


For any suggestions or comments, please send an email to unitrap@crg.es