Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST274577
Clone ID OST274577
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST274577
Sequence
GACTGAGACCCAAACTCCAGCTAGTAAAATCAGCTTTTACGGGAGAAAACTCACGGCCTTGTGGTTGAGAACCAGGAGTT
AAGAACACGCTTGGGAATGGACACGCTGGATCCTGACGAGGTTCCAGAGGTGGAGGCCAAGGGAGAAGCAAGCCAGAAAC
TGAAAACTCAACTGAGGAGGAGTTCAGCTGTAGAAAGAGCCGCCACACTCACCGGATGGATAGCTTACTGCTCTGCAGCG
CTGAAGGACTTGCGAAAGCCCTCATTACACGTCCTGCCATGCTGAAGAGCTCTTCCTGAGAAATTAAAAACTTTAACCCT
GGTTATTTCCAAAGAA
Sequence Type mRNA
Unitrap ID UNI18206

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 5423332..5430379 196
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020484 (Xbp1) NM_013842 X-box binding protein 1 Gene [Source:MGI (curated);Acc:Xbp1-001]

 
Come back to gene ENSMUSG00000020484


For any suggestions or comments, please send an email to unitrap@crg.es