Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST274340
Clone ID OST274340
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST274340
Sequence
GACTGAGGTGACGCATGGGCTGAGGGCCTCGATGGCCTTTCCCTCCCTGAGGACACAGAGACTGTCACAGCGAGCCGGTA
TGGCTGGACCTACTCATACCTCTCTGATGATGAGGACCTGCTGGCAGATGATGCATCAGGAGATGGCCTCGGCAGCGGAG
ACGTGGGCAGCGGGGACTTCCAGATGGTGGAAGCCCCCTCCAAGTCAACCAGGACTAGTCAGCCACAGCCCAAGCAACAA
AAGAAGATAAAAGCTCCCCAGGACGTAGCTATGGAGGATCTTGAAGATAAGAGCTAAAATCCCTGCCTCTTCTACCAGAA
GATGGTCAACAGCACTGAGAAAGATTTGGAGGAACTTTGGAAAAAATATTAGCATATTTCACTTTCCTAGACACCTCTTC
TACAGCGGACCCTGACCTCCCCTGGAGGTGTATATTGGGACCGAAGAGGACACAGAGAAAGACTGGAGGGCCACCTCTAG
CAGTCAACTCCTTTTGTAATAACC
Sequence Type mRNA
Unitrap ID UNI15356

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 8964900..8965215 316
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000071653 (1810009A15Rik) NM_025463 RIKEN cDNA 1810009A15 gene Gene [Source:MGI Symbol;Acc:MGI:1913526]

 
Come back to gene ENSMUSG00000071653


For any suggestions or comments, please send an email to unitrap@crg.es