Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST274295
Clone ID OST274295
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST274295
Sequence
GACTGAGAAGATGAATAATCTGTCATTTAGTGAGCTATGTTGCCTCTTCTGCTGTCCACCTTGCCCAGGGAAAATTGCTT
CAAAACTAGCATTCTTGCCACCTGATCCAACTTACACACTGATGTGTGATGAAAGTGGAAGCCGCTGGACCTTACACCTG
TCAGAGCGAGCAGACTGGCAGTACTCGTCCCGAGAAAAAGATGCTATTGAGTGTTTCATGACAAGAACCAGTAAAGGCAA
CAGAATTGCTTGTATGAAAAAACA
Sequence Type mRNA
Unitrap ID UNI2811

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 21752841..21753091 251
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047368 (5730446C15Rik) NM_146096 family with sequence similarity 108, member B Gene [Source:MGI Symbol;Acc:MGI:1917816]

 
Come back to gene ENSMUSG00000047368


For any suggestions or comments, please send an email to unitrap@crg.es