Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST274288
Clone ID OST274288
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST274288
Sequence
GCGAGAATGCCCACCTCGCCCTACAGNTGCGGGACTCCCAGNAGAACCACNGAAGAGATCATCTCCACATACAGGAGTCA
TCTACCTGAATGCTGCTCGGGGCTACATGGAACAAGACGTCTACAACATCCTACTTTGAATCCTCAGCATGCANGAGTGA
GGCAGGCTCACTGTGTGCCCTCAGGGATAAAGGCATTTCTCTTTTGGAATNANGAGGCTCGATCAAACTGGGGGGGGCAC
GTGGGAGGACGGGGATTACCCACTAGTGGTGCTGTGGGTGGGGCTTTACAGGACACACGAACTCCAAACCTGNAAACCTG
GACCCTGGAATCAGCACAGATGAGACCAGAATTGNGGATGNAAANTAACTNCGGGGGAAATAAAGCNGAAAACCGATGGG
AAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI23164

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 96493127..96494955 157
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038354 (Ankrd35) NM_001081139 ankyrin repeat domain 35 Gene [Source:MGI (curated);Acc:Ankrd35-001]

 
Come back to gene ENSMUSG00000038354


For any suggestions or comments, please send an email to unitrap@crg.es