Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone YTC263
Clone ID YTC263
Vector pGT0Lxf
Project baygenomics

Sequence tag YTC263
Sequence
ATTTTAACTTCTTCTCCCTGGTGCTGGCCCTGTGGGATGCTGTAACGGGGCCTCTTTGGAGGATGACAGACGTGGTGGCT
GCTTTCCTCGCTCACATCTCCAGCAGTGCAGTGGCTATGGCCATTCTCCTGTGGACCCCCTGCCAGCTAGCACTGGAGCT
GTTGGCCTCAGCCGCCCGCCTGCTGGCCAGCTGTGTGGTTTTCCATCTCACTGGATTGGTGTTGCTGGCTTGCGTGCTGG
CAGTGATTTTGATTGTGTTGCACCCAGAACAAACCCTGAGGCTGGCCACCCAAGCTCTCAGTCAGCTTCATGCCCGCCCA
TCTTACCACCGGCTTTGGGAGGATATCGT
Sequence Type mRNA
Unitrap ID UNI5116

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 43920209..43920552 342
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053128 (Rnf26) NM_153762 ring finger protein 26 Gene [Source:MGI Symbol;Acc:MGI:2388131]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 76446802..76447145 342
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000072476 (AC131340.4)  

 
Come back to gene ENSMUSG00000072476


For any suggestions or comments, please send an email to unitrap@crg.es