Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone YTC269
Clone ID YTC269
Vector pGT0Lxf
Project baygenomics

Sequence tag YTC269
Sequence
GGAAGTGACGGAGCCGAGCTAGCGCGACGAGGCCGCCTCTATGGTCTTCCTCTCCTTCTGGAGTCGGGAAATGGCCGCTG
TGTAGTTAGCACGGAGGTAAACCCTGCACGCACATCGTGCTTCGGCGTGTCAGGTATTTGAATTTAGAGTTTAGTTTCCC
ATAACATTTTCTACAAGAAGAATCTTGGTAGTGTCTCAAAGACATCACTGACTTCTGGATCCTGCAGAAAGCCCA
Sequence Type mRNA
Unitrap ID UNI5118

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 20032278..20037915 136
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037608 (Bclaf1) NM_001025393 BCL2-associated transcription factor 1 Gene [Source:MGI Symbol;Acc:MGI:1917580]

 
Come back to gene ENSMUSG00000037608


For any suggestions or comments, please send an email to unitrap@crg.es