Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone YTC270
Clone ID YTC270
Vector pGT0Lxf
Project baygenomics

Sequence tag YTC270
Sequence
GCAATGGAACAAAGCATTTTTCATCTGGAGAAAAACATCAAGAATTTCCCACCAGCAGAATCGCACCATGATAAGTTTGT
GGAAAAGATGATGAGCTTTACCCAGAATGCCAGAGAACAGTATGACAAACTGTCCACCATGCACAGCAATATGTTGAAGC
TCTATGAGAGTCTGGGAGAATACTTTTTTCCCCGGGTGTAGACGTTGAACTTTTTTTTTTTTTTTGGTGATCTCAACACC
TTCAGAACCCTATTTTTGGAAGCACTGAAAGAAAACCACAAGTTAACTTTAACCGAAGAGAAGAGCTGTTAGATTTTTTT
TTTTCAAAAGAGAAAGCGGAACAAGAGAAGCTGGAACGCCAGAAGAAGAAGAAGCAACTCATTGACATAAACAAAGAGGG
TGATGAGACGGGAGTGATGGATAATCTTCTGGAAGCCCTACAGTCAGGTGCAGCATTCAGAGACCGCAGAAAGCGAATTC
CAAGAAAT
Sequence Type mRNA
Unitrap ID UNI1272

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 126713504..126862593 120
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034480 (Diap2) NM_017398 diaphanous homolog 2 (Drosophila) Gene [Source:MGI (curated);Acc:Diap2-001]

 
Come back to gene ENSMUSG00000034480


For any suggestions or comments, please send an email to unitrap@crg.es