Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST273841
Clone ID OST273841
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST273841
Sequence
GACTGAGGCCTTCGAGGACATCTACCTGGAGGAGCGGAAGACCATCAAGGTTCTGCTGGAGTACGCCGACAAGATGTTCA
CCTATGTCTTTGTGTTGGAGATGCTGCTCAAGTGGGTGGCCTACGGCTTCAAGAAGTACTTCACCAACGCCTGGTGCTGG
CTGGACTTCCTAATTGTGGACGTCTCACTGGTCAGCCTCGTGGCCAACACCTTAGGCTTTGCCGAGATGGGTCCCATCAA
GTCCCTGAGGACACTGCGTGCACTTCGACCCCTGAGGGCTTTGTCACGATTCGAGGGCATGAGGGTGAGNGGANNCTCTN
TCAACCCAGCAATCNNCTGAATATGGAATGTGACTCCTCGTNTGNCTCATCNTCTGGCTCATCTTCAGCATCATGGGCGT
GAACCTCTTCCCCGGNAAGTTCGGNAGGNGCATCAACCAGACCGAAGGGGACCTGCCTCTGAACTACACCATTG
Sequence Type mRNA
Unitrap ID UNI23176

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 119404738..119410915 178
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032511 (Scn5a) NP_067519 sodium channel, voltage-gated, type V, alpha Gene [Source:MGI (curated);Acc:Scn5a-001]

 
Come back to gene ENSMUSG00000032511


For any suggestions or comments, please send an email to unitrap@crg.es