Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST273817
Clone ID OST273817
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST273817
Sequence
GACTGAGACTCAAAGGAAGAGGAAACACTCAGGAAGGGATGGAGAGATGGACAGAGCTGAATGCCTGTGGGAAGCACGGA
GAGAAGCAGAGGACTATGGGAGGCCAGGAGCAGGAGACCTGAGGGCCTGGTGAGCGGCACAGACCTCTGCACTCGGTGAG
ATTCCCAGCAGGCCTAGCTCCAAGCCTCCCAGGGTTACTCTGAGGTCTGCCTATGTTGCGGATCAGAGCTCTGAATTCTC
AGCCTGCCTTAATTTGCTGTGGGACTGTCCAGGATTCCAGGGACTCACGGATCCTAGCCTGATAAAGTCACTGAAGACTC
TGCCTCAACCGGTCCTGGGTTGTTCTTCCAAGTCACCTCCTTAGACCCAGCGATGCAAGGCTTGTCCCCCACAAGTGAAC
TCCAGCTCCTGAGATCTTCAGGGCTACTGCACGGGGAGTATAGGAGTCTGTCCTCGTCGCCTCCGTGATGTAGCATGCGG
AGGGCTACAGGGGGACTGCAACTGGCCAAAC
Sequence Type mRNA
Unitrap ID UNI14695

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 25940339..25941312 288
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074274 (D930028M14Rik) RIKEN cDNA D930028M14 gene Gene [Source:MGI Symbol;Acc:MGI:3687343]

 
Come back to gene ENSMUSG00000074274


For any suggestions or comments, please send an email to unitrap@crg.es