Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST273776
Clone ID OST273776
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST273776
Sequence
GACTTAATGCAGGTAGCTCCAAATGGGAGGGGCAGACGCACGCTCTGGAGACTTTGCTTGGACATCCNGNGATCGGGAGC
TGAAGGCTCTGAGGAGTCAGCTGGACATGAAGCACAAAGAGGTTGGAATATTGCATCAGCAGATAGAAGAACATGAGAAA
ACCAAGCAAGAAATGGCCATGGAGTACAAGGAGGAGTTACTGAAGCCTGCAGGAGGAATTAANCAGACTGAANAGAAGCT
ATGAAAAGCTGCAGAAAAAGCAACTAAGAGAATTCTAGAGGAAATACCAAAAGTTTTTCGAGAGGATCGGTTCTGAGATT
GAGANGCTAACCTGGAAAAATAGAGGAATTCCGACAGAAGTCTCTGCA
Sequence Type mRNA
Unitrap ID UNI14654

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 102509749..102521236 109
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032534 (AL450317.13) NM_001081122 centrosomal protein 63 [Source:RefSeq peptide;Acc:NP_001074591]

 
Come back to gene ENSMUSG00000032534


For any suggestions or comments, please send an email to unitrap@crg.es