Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone YTC348
Clone ID YTC348
Vector pGT0Lxf
Project baygenomics

Sequence tag YTC348
Sequence
CGCTGTCAGCGCTAAAAGTGGCTCCCGACGCCGCCGAAGAACGAGAGTTGATGGCGCGCAATATTTTGAAGGAAGTGGAG
GCTCAGGCTCTAGCCTTGGCCACGAACAGGACTGGTAGCGAAATGCTGCAGGAGCTTTTGGGGTTCAGTCCTTTGAAACC
CCTGTGTCGAGTGTGGGCCGCTCTGCGCCCCAACTTGCGCTTCGTGGCTTGTCATCGGTGTGGGGTCCACGTATTACAAA
GTGCTTTGCTGCAGCTACCTCGATTGCTGAGGCGTCCTGCGGAGGCAGAGGAGGAGGAGGAGGAAGAGGAGGAGGGTGGT
CCCTCGCAAACTCTGGAGGAGCTAGTCCTGGGACTAGCCGCTGAAGTGTGTGATGATTTTCTGTTCTTCTGTGGAGACAC
GCATGGCAGCTTCGTGGTCAGAACTCTGCTGCAGGTCTTGGGAGGTACTCTTTTGGAGTCCGAGAGAGGCAAGCCCCGTG
GCTCCCAGTCGTCTGAAACACAGAGGACTTCAGCTCGGGAATGTAAACCAACTGATTTTGAGGTTCCTAAAACCTTCTTG
AATCGCCTTCAGGACCTGAGCGCCTGCTTTCTGAAGGACATTGCT
Sequence Type mRNA
Unitrap ID UNI5139

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 56364813..56368278 452
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019297 (2610027L16Rik) NM_026403 RIKEN cDNA 2610027L16 gene Gene [Source:MGI Symbol;Acc:MGI:1915092]

 
Come back to gene ENSMUSG00000019297


For any suggestions or comments, please send an email to unitrap@crg.es