Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone YTC349
Clone ID YTC349
Vector pGT0Lxf
Project baygenomics

Sequence tag YTC349
Sequence
ACCCCTCACTGGAGAGACATTTTAAGGGCCACCGAGATGCAGTCACCTGTGTGGACTTCAGTCTCAACACCAAGCACTTG
GCCAGTGGCTCCATGGACTCAACCCTCATGATCTGGCACATGAAGTCCCAGTCACGTGCCTACCGCTTCACGGGCCACAA
GGACGCTGTGACCTGTGTGAATTTCTCCCCATCCGGACACCTTCTTGCCTCAGGCTCCCGAGACAAGACTGTTCGCATCT
GGGTACCCAATGTCAAAGGTGAGTCAACTGTATTTCGTGCACACACGGCCACAGTGAGGAGTGTCCACTTCTGCAGCGAT
GGCCAGTCACTTGTGACAGCCTCTGATGACAAGACAGTCAAAGTGTGGTCAACTCATCGCCAGAGATTTCTGTTTTCCCT
GACCCAGCACATCAACTGGGTCCGCTGTGCCAAGTTCTCCCCTGACGGGCGGCTCATCGTGTCTGCCAGTGATGACAAGA
CTGTCAAGCTGTGGGACAAGACCAGCCGGGAATGTATCCACTCATACTGTGAGCACGGCGGTTTTGTCACCTTTTGTGGA
CTTCCACCCCAGTGGTACTTGCATTGTTGTTGCCGGCATGGACAACACGGTGAAGGTGTGGGATGCGCGGACTCATCGGC
TGTTGCAGCATTATCATGT
Sequence Type mRNA
Unitrap ID UNI5140

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 106185187..106190435 180
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023345 (Wdr51a) NM_027354 WD repeat domain 51A Gene [Source:MGI Symbol;Acc:MGI:1917485]

 
Come back to gene ENSMUSG00000023345


For any suggestions or comments, please send an email to unitrap@crg.es