Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST271915
Clone ID OST271915
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST271915
Sequence
ACTGAGGAGAGTCACCGTCATCACCCTGTGAAGAAAGGGCCTCGGCTCCTGCATGCAGCTCTGCCTAATACCTTGACATC
TGTCCCCGCGTCTCATTGGGTCCCTAGTCCTGCCGGTAGCTCCAGGCCTCTACGAACACGGCTGGNAACGTTACTGTGCC
TGNTACCACAATTCAAAAATCTACAGACAGGNCAANTGTGGATGAGAACGTAACACTGCTCGTGTAAAATAAAGTTGCAG
AACTGCCAAATAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI23198

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 75391126..75391256 131
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000901 (Mmp11) NM_008606 matrix metallopeptidase 11 Gene [Source:MGI (curated);Acc:Mmp11-002]

 
Come back to gene ENSMUSG00000000901


For any suggestions or comments, please send an email to unitrap@crg.es