Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone YTC360
Clone ID YTC360
Vector pGT0Lxf
Project baygenomics

Sequence tag YTC360
Sequence
CCAAAATGAAAGATGTGTACCTAAAGAACCCTCAGATGGGAGACCCAGCCAGCCTGGACCAGAAGCTCACCGAAGTCACC
CAGAACATAGAGAAACTGCGGCTGGAGGCTCAGAAGTTTGAGGCCTGGCTGGCTGAGGTAGAAGGCAGACTTCCAGCTCG
GAGTGAGCAGGCAC
Sequence Type mRNA
Unitrap ID UNI5144

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 30892132..30892797 124
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075415 (Fnbp1) NM_019406 formin binding protein 1 Gene [Source:MGI (curated);Acc:Fnbp1-001]

 
Come back to gene ENSMUSG00000075415


For any suggestions or comments, please send an email to unitrap@crg.es