Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XT0182
Clone ID XT0182
Vector pGT0lxf
Project sanger

Sequence tag XT0182
Sequence
GGTTTTTTTTTCCTTTCCTCCCTTCCAAGATGGCCGAAGTGGATTCCCCCTCTTAACGATTTGGAGTCTCCCTCGACCAC
CTCCTCTTTGTGCAGCAGCCCCCTGCTAAGACCCTGCTTGCGAG
Sequence Type mRNA
Unitrap ID UNI424

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 97560520..97560641 122
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018537 (Pcgf2) NM_009545 polycomb group ring finger 2 Gene [Source:MGI (curated);Acc:Pcgf2-001]

 
Come back to gene ENSMUSG00000018537


For any suggestions or comments, please send an email to unitrap@crg.es