Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone YTC193
Clone ID YTC193
Vector pGT0Lxf
Project baygenomics

Sequence tag YTC193
Sequence
AGAAGGTCGGCGAGCCCTGGTCCCCGCGGTTCCCGATCGAGTTCCTCTTCAGTCCGCGAATCTGCCGGAGAGGTTCGATC
GCCGACACAGGGCGCGGGGAGCCGGGCCGCCCCGTCGGGGGAATCTGAGACGTCCTCTGGGCTGCGTTTGACCGCCGTGC
CCGCCGTGCACGGAGCGCGTCCACTGTGTCCACCCCCCCCCCACCCCCTTTACCCGCAACCTCAAGCTAGCTTTTTTTTT
TTTTTTGGAGAGTTCCGTGAGCGCCAGGGCTACCTAAGGAGACCCTGTCTCAAAAGAGAACAAAAACG
Sequence Type mRNA
Unitrap ID UNI451

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 83403540..83403739 192
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031714 (Gab1) NM_021356 growth factor receptor bound protein 2-associated protein 1 Gene [Source:MGI Symbol;Acc:MGI:108088]

 
Come back to gene ENSMUSG00000031714


For any suggestions or comments, please send an email to unitrap@crg.es