Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST271147
Clone ID OST271147
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST271147
Sequence
ACTGAGGGATGAAGCTGAAATGGAGTATTTGAAGATAGCTCAGGACCTGGAGATGTATGGTGTGAACTACTTTACAATCC
GGATTACTATGGNCCCACNGNNNNTGATTGGAGATGGACTGCCTNTTGGACTTCCTCNCTAGNGTNCCCTGATNAACAGG
CTGACCCTTCAGCATCTGCTTNNNANGCCATGACCTANNNATNATGNCNTACGAGCAGACTGANGTCTTTAACATAGTTC
AACCACATGAANAGCCNAAGCCGGNGTANTTAGAAAGGCTACGTAACNCAGAGNTNAAGGCTTAAGNATGTGTCNCTNGA
NCTATGTATTGGNAACCATGACCTATTTATGAGGCCGACGGAAAGCTGACTCTTTAGAAGTTCANCANANGAAAGCCCAG
GCCAGGGAAGAGAAGGCTAGGAAGCAGATGGAAAGGCAGCGGCTGGCTCGAGAGAAGCAGATGCGGGAGGAGGCCGAGCG
TACAAGAGATGAGTTAGAGAGGAGGCTCCTGCAGATGAT
Sequence Type mRNA
Unitrap ID UNI10441

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4691126..4703758 93
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000009073 (Nf2) NM_010898 neurofibromatosis 2 Gene [Source:MGI (curated);Acc:Nf2-001]

 
Come back to gene ENSMUSG00000009073


For any suggestions or comments, please send an email to unitrap@crg.es